Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187L24

Clone ID RBdS187L24
HP ID HP00037
Gene ID 1933
Gene Symbol EEF1B2
Protein Name eukaryotic translation elongation factor 1 beta 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001959.3
Length of RefSeq (bp) 964
Chromosome 2q33-q34
Reference DDBJ accession
UniGene Hs.421608
5'-terminal sequence GGAGGCCGGGCGTCTTCGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCCGTCATCTTCGG
2011.08.28