Prev. |  KEGG KO K03232 > 

RIKEN DNA Bank Human Resource - EEF1B2

Gene ID NCBI Gene 1933 |  KEGG hsa:1933
Gene Symbol EEF1B2
Protein Name eukaryotic translation elongation factor 1 beta 2
Synonyms EEF1B|EEF1B1|EF1B
Ortholog resources KEGG ortholog (KEGG orthology K03232) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13268 pUC-T7-EMCV-eEF1Balpha EMCV IRES-dependent expression vector of human eEF1Balpha

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067324 IRAK168F04 pBluescriptR BC067787 NM_021121 Full
HGY082519 IRAL006E23 pOTB7 BC000211 NM_021121 Full
HGY085367 IRAL013G23 pOTB7 BC004931 NM_021121 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040503 ARe01E07 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR040551 ARe01G07 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR041301 ARe03E05 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR048052 ARe20C04 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR052921 ARe32F01 pKA1U5 NM_001959.3  
ATCCTGGCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTG
HKR057203 ARe43A03 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR071202 ARe78A02 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR071324 ARe78F04 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR072104 ARe80E08 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR073634 ARe84B10 pKA1U5 NM_001959.3  
GGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCCGTCATCTTCGGGAGCCGTGGAGCTCTC
HKR073635 ARe84B11 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR076478 ARe91D06 pKA1U5 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR079775 ARe99H07 pKA1U5 NM_001959.3  
TGCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCT
HKR162922 ARi07F02 pGCAP10 NM_001959.3  
GCCTTTNNNCCTCCTCCTTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCT
HKR165330 ARi13F10 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR169378 ARi23H10 pGCAP10 NM_001959.3  
CTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTCCC
HKR170032 ARi25B08 pGCAP10 NM_001959.3  
GCTTTTTCCTCTCTTCCCGNGGGGCGCCCGGATTTGTCTCTCTCTTTCNGCTGCTCCCCT
HKR170059 ARi25C11 pGCAP10 NM_001959.3  
GGCCCCAGCCTCGAGGCCGGGCGTCTTCGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCC
HKR172807 ARi32A07 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR181348 ARi53G04 pGCAP10 NM_001959.3  
GCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTCC
HKR222322 ARiS055N10 pGCAP10 NM_001959.3  
GCTTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR234186 ARiS085H18 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR235291 ARiS088D19 pGCAP10 NM_001959.3  
GCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTCC
HKR341305 RBb53E09 pGCAP1 NM_001959.3  
GAGGACAACTTGGACCCGCAGTTCCGCCGGAAGTGGCCCCAGCCTCGAGGCCGGGCGTCT
HKR342049 RBb55C01 pGCAP1 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR342880 RBb57D08 pGCAP1 NM_001959.3  
CTCTTTCTGCTGCTCCCCAGCTCTCGGATACAGCCGACACCATGGGTTTCGGAGACCTGA
HKR348572 RBb71H04 pGCAP1 NM_001959.3  
GGTGACAATTTGCGCGCTCTCTTTCTGCTGCTCCCCAGCTCTCGGATACAGCCGACACCA
HKR376974 RBd42H06 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR385228 RBd63B04 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR386176 RBd65H08 pGCAP10 NM_001959.3  
GATCTTCGGGAGCCGTGGAGGTACGAACTTAAGACATGCCTATTTTATTAATTTACTTCC
HKR387258 RBd68C10 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR395257 RBd88C09 pGCAP10 NM_001959.3  
CGCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCT
HKR396451 RBd91C03 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCCTCCCCGTGGGGCGCCCACAATTGGCGGGTTCTCTCCAAACTGCTC
HKR396860 RBd92C12 pGCAP10 NM_001959.3  
TTTTTTTTTTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTG
HKR396879 RBd92D07 pGCAP10 NM_001959.3  
GCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTCC
HKR405623 RBdS014A23 pGCAP10 NM_001959.3  
GGTCTTCGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCCGTCATCTTCGGGAGCCGTGGA
HKR420505 RBdS051E09 pGCAP10 NM_001959.3  
GGGGCGTCTTCGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCCGTCATCTTCGGGAGCCG
HKR428014 RBdS070A14 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR430021 RBdS075A21 pGCAP10 NM_001959.3  
GGTCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGC
HKR430170 RBdS075H02 pGCAP10 NM_001959.3  
CGGCCGGNCGATGCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTC
HKR432776 RBdS081P16 pGCAP10 NM_001959.3  
HKR441652 RBdS104C04 pGCAP10 NM_001959.3  
GAGGGCTGGTTCCCGTCATCTTCGGGAGCCGTGGAGGTACGAACTTAAGACATGCCTATT
HKR442104 RBdS105E08 pGCAP10 NM_001959.3  
TGCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCT
HKR444301 RBdS110M13 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR474828 RBdS187B04 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR475034 RBdS187J18 pGCAP10 NM_001959.3  
GCCTTTTTCCTCTCTTCAGCGTGGGGCGCCCACAATTTGCGCGCTCTCTTTCTGCTGCTC
HKR475088 RBdS187L24 pGCAP10 NM_001959.3  
GGAGGCCGGGCGTCTTCGGTCATCTCCGGCGCTTCTAGGGCTGGTTCCCGTCATCTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl