Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187J20

Clone ID RBdS187J20
HP ID HP10761
Gene ID 80279
Gene Symbol CDK5RAP3
Protein Name CDK5 regulatory subunit associated protein 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_176096.1
Length of RefSeq (bp) 1884
Chromosome 17q21.32
Reference DDBJ accession
UniGene Hs.20157
5'-terminal sequence GAGTCTCCAGCCTGAAGCGGAAGTGGAGGAAAGATGGAGGACCATCAGCACGTGCCCATC
2011.08.28