Prev. | 

RIKEN DNA Bank Human Resource - CDK5RAP3

Gene ID NCBI Gene 80279 |  KEGG hsa:80279
Gene Symbol CDK5RAP3
Protein Name CDK5 regulatory subunit associated protein 3
Synonyms C53|HSF-27|IC53|LZAP|MST016|OK/SW-cl.114|PP1553
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069652 IRAK174C04 pCMV-SPORT6 BC072435 NM_176096 Full
HGY084250 IRAL010K10 pOTB7 BC013407 NM_176095 Partial
HGY090647 IRAL026K07 pOTB7 BC009957 NM_176096 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364402 RBd11A02 pGCAP10 NM_176096.1  
AGAGCCTGAAGCGGAAGTGGAGGAAAGATGGAGGACCATCAGCACGTGCCCATCGACATC
HKR405470 RBdS013L06 pGCAP10 NM_176096.1  
GAGCCTGAAGCGGAANTGGAGGAAAGATGGAGGACCATCAGCACGTGCCCATCGACATCC
HKR475036 RBdS187J20 pGCAP10 NM_176096.1  
GAGTCTCCAGCCTGAAGCGGAAGTGGAGGAAAGATGGAGGACCATCAGCACGTGCCCATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl