Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177N22

Clone ID RBdS177N22
HP ID HP09271
Gene ID 23076
Gene Symbol RRP1B
Protein Name ribosomal RNA processing 1 homolog B (S. cerevisiae)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015056.2
Length of RefSeq (bp) 5087
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.654727
5'-terminal sequence GGACGGTGGCTGGCTGCTCCGCANCGCTCGGCTGGCTGCAGCGGCACCGCGGGTTGCGCG
2011.08.28