Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177F18

Clone ID RBdS177F18
HP ID HP00155
Gene ID 1915
Gene Symbol EEF1A1
Protein Name eukaryotic translation elongation factor 1 alpha 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001402.5
Length of RefSeq (bp) 3528
Chromosome 6q14.1
Reference DDBJ accession
UniGene Hs.586423
5'-terminal sequence GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
2011.08.28