Prev. |  KEGG KO K03231 > 

RIKEN DNA Bank Human Resource - EEF1A1

Gene ID NCBI Gene 1915 |  KEGG hsa:1915
Gene Symbol EEF1A1
Protein Name eukaryotic translation elongation factor 1 alpha 1
Synonyms CCS-3|CCS3|EE1A1|EEF-1|EEF1A|EF-Tu|EF1A|GRAF-1EF|HNGC:16303|LENG7|PTI1|eEF1A-1
Ortholog resources KEGG ortholog (KEGG orthology K03231) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13266 pUC-T7-EMCV-His-eEF1A EMCV IRES-dependent expression vector of human eEF1A

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004820 IRAK012A20 pCMV-SPORT6 BC038339 NM_001402 Full
HGX005579 IRAK013P19 pCMV-SPORT6 BC012509 NM_001402 Partial
HGX005639 IRAK014B15 pCMV-SPORT6 BC009733 NM_001402 Full
HGX005850 IRAK014K10 pCMV-SPORT6 BC010735 NM_001402 Full
HGX006105 IRAK015E09 pCMV-SPORT6 BC014892 NM_001402 Partial
HGX007847 IRAK019K07 pCMV-SPORT6 BC008587 NM_001402 Full
HGX008320 IRAK020N08 pCMV-SPORT6 BC018150 NM_001402 Full
HGX008465 IRAK021C17 pCMV-SPORT6 BC012891 NM_001402 Full
HGX011683 IRAK029D11 pCMV-SPORT6 BC019669 NM_001402 Full
HGX053663 IRAK134C15 pCMV-SPORT6 BC063511 NM_001402 Partial
HGX066447 IRAK166B23 pCMV-SPORT6 BC071741 NM_001402 Full
HGX066478 IRAK166D06 pCMV-SPORT6 BC071619 NM_001402 Full/var
HGX066507 IRAK166E11 pCMV-SPORT6 BC071727 NM_001402 Full/var
HGY066898 IRAK167E02 pBluescriptR BC066893 NM_001402 Full
HGX069601 IRAK174A01 pCMV-SPORT6 BC072385 NM_001402 Full
HGY099353 IRAL048G09 pDNR-LIB BC070500 NM_001402 Partial/var
HGY089610 IRAL024A10 pOTB7 BC018641 NM_001402 Full
HGY090199 IRAL025I07 pOTB7 BC009875 NM_001402 Full
HGY092080 IRAL030D08 pOTB7 BC014224 NM_001402 Full
HGY092544 IRAL031F24 pDNR-LIB BC021686 NM_001402 Full
HGY092655 IRAL031K15 pDNR-LIB BC014377 NM_001402 Partial
HGY092856 IRAL032C08 pDNR-LIB BC028674 NM_001402 Full
HGY094004 IRAL035A04 pDNR-LIB BC022412 NM_001402 Partial/var
HGY100574 IRAL051H06 pDNR-LIB BC065761 NM_001402 Partial
HGY103094 IRAL057M06 pDNR-LIB BC070131 NM_001402 Partial
HGY103266 IRAL058C18 pOTB7 BC071841 NM_001402 Full/var
HGY103963 IRAL059P03 pOTB7 BC082268 NM_001402 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002249 W01A005K09 pENTR-TOPO flj0053g24 AK098623 NM_001402  
HGE002253 W01A005K13 pENTR-TOPO flj0053g24 AK098623 NM_001402  
HGE002289 W01A005M01 pENTR-TOPO IRAK014B15 BC009733 NM_001402  
HGE002263 W01A005K23 pENTR-TOPO IRAK167E02 BC066893 NM_001402  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041323 ARe03F03 pKA1U5 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR041629 ARe04B05 pKA1U5 NM_001402.5  
TGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR042005 ARe05A05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR042108 ARe05E12 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR042405 ARe06A05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR042546 ARe06G02 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTTGCCGCCAGAACACANGCTGGTCGTGCAAAACTACCCCTAA
HKR043650 ARe09C02 pKA1U5 NM_001402.5  
TTGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR044571 ARe11H03 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTTCGATGAAAACTACCCCTAAA
HKR045255 ARe13C07 pKA1U5 NM_001402.5  
TGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR046028 ARe15B04 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR046827 ARe17B03 pKA1U5 NM_001402.5  
TGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR046877 ARe17D05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR046924 ARe17F04 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR047282 ARe18D10 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR047374 ARe18H06 pKA1U5 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR048121 ARe20F01 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR049257 ARe23C09 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR049356 ARe23G12 pKA1U5 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACCCGTTGATCGTGAAAACTACCCCTAAA
HKR050545 ARe26G01 pKA1U5 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR050906 ARe27E10 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR051602 ARe29A02 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR052004 ARe30A04 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR052131 ARe30F11 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR053653 ARe34C05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACANGCTGGTCGTGAAAACTACCCCTAAAA
HKR053659 ARe34C11 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR055727 ARe39F07 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTTCGTGAAAACTACCCCTAAAA
HKR058026 ARe45B02 pKA1U5 NM_001402.5  
CTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTCGTGAAAACTACCCCTAAAAGC
HKR058029 ARe45B05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR058100 ARe45E04 pKA1U5 NM_001402.5  
GcTTTTTCgCaACGGGTTTGCCGCCAGTAACACAGGGTGTTCGCTGAAAACATACCCCG
HKR058553 ARe46G09 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR059657 ARe49C09 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR060948 ARe52G04 pKA1U5 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACNCANGNTGTCGTGAAAACTACCCCTAA
HKR061673 ARe54D01 pKA1U5 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR062411 ARe56A11 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACACGCTGNTCGTGAAAACTACCCCTAAAA
HKR063205 ARe58A05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTTGTCGTGAAAACTACCCCTAAAAG
HKR063633 ARe59B09 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR063703 ARe59E07 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR063721 ARe59F01 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR063732 ARe59F12 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR064928 ARe62F08 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR065302 ARe63E06 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR066005 ARe65A05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR066173 ARe65H05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR066572 ARe66H04 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR066807 ARe67A07 pKA1U5 NM_001402.5  
TATGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR066808 ARe67A08 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR067301 ARe68E05 pKA1U5 NM_001402.5  
TGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR067347 ARe68G03 pKA1U5 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR067601 ARe69A01 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR068101 ARe70E05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTTCGTGAAAACTACCCCTAAAA
HKR068170 ARe70H02 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTCGTGAAAACTACCCCTAAAAG
HKR068484 ARe71D12 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR068525 ARe71F05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACACGTTGTTCGTGAAAACTACCCCTAAAA
HKR069756 ARe74G12 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR072002 ARe80A02 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTTGCCGCCAGAACACACGNTGGTCGTGAAAACTACCCCTAAA
HKR072011 ARe80A11 pKA1U5 NM_001402.5  
ATCCTGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCT
HKR072545 ARe81G01 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR073702 ARe84E06 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR073727 ARe84F07 pKA1U5 NM_001402.5  
ATCCTGCTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCC
HKR074434 ARe86B10 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR074454 ARe86C06 pKA1U5 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR074545 ARe86G01 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR075697 ARe89E01 pKA1U5 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGNTCGTGAAAACTACCCCTA
HKR075779 ARe89H11 pKA1U5 NM_001402.5  
ATCCTGTGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCC
HKR076121 ARe90F01 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR076950 ARe92G06 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTCGTGAAAACTACCCCTAAAAG
HKR077232 ARe93B08 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTCGTGAAAACTACCCCTAAAAG
HKR077299 ARe93E03 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR077609 ARe94A09 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR077656 ARe94C08 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR078401 ARe96A01 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR079235 ARe98B11 pKA1U5 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR080435 ARf01B11 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR080955 ARf02G11 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR082851 ARf07C03 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTCGTGAAAACTACCCCTAAAAG
HKR082955 ARf07G11 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTCGTGAAAACTACCCCTAAAAG
HKR160553 ARi01G09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR161351 ARi03G07 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR161726 ARi04F06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR162904 ARi07E08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR163280 ARi08D08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR163721 ARi09F01 pGCAP10 NM_001402.5  
GTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR164150 ARi10G06 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR164499 ARi11E03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR164883 ARi12D11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR166555 ARi16G11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR166811 ARi17A11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR167380 ARi18H12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR167602 ARi19A02 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR167780 ARi19H12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR168103 ARi20E07 pGCAP10 NM_001402.5  
TGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR168145 ARi20G01 pGCAP10 NM_001402.5  
TTTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR168149 ARi20G05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR168407 ARi21A07 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR168804 ARi22A04 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR168921 ARi22F01 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR168979 ARi22H11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR169203 ARi23A03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR169706 ARi24E10 pGCAP10 NM_001402.5  
GCTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR170081 ARi25D09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR170101 ARi25E05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR170532 ARi26F12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR170549 ARi26G05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR170555 ARi26G11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR170860 ARi27C12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR170927 ARi27F07 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR171725 ARi29F05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR172082 ARi30D10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR172107 ARi30E11 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR172427 ARi31B03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR172572 ARi31H04 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR172805 ARi32A05 pGCAP10 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR173755 ARi34G11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR174883 ARi37D11 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR175652 ARi39C04 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR176052 ARi40C04 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR176056 ARi40C08 pGCAP10 NM_001402.5  
TGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR176174 ARi40H06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR176434 ARi41B10 pGCAP10 NM_001402.5  
GCTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR176577 ARi41H09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR176836 ARi42B12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCANAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR177254 ARi43C06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR177273 ARi43D01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR177682 ARi44D10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR177704 ARi44E08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR177707 ARi44E11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR178056 ARi45C08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR178528 ARi46F08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR178579 ARi46H11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR178860 ARi47C12 pGCAP10 NM_001402.5  
CGGCCGGCCGATGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACT
HKR178878 ARi47D06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR178924 ARi47F04 pGCAP10 NM_001402.5  
GCTTTTTCNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR179350 ARi48G06 pGCAP10 NM_001402.5  
GCTTTTTCNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR179655 ARi49C07 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR180827 ARi52B03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR181225 ARi53B01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR181253 ARi53C05 pGCAP10 NM_001402.5  
GCTTTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCT
HKR181255 ARi53C07 pGCAP10 NM_001402.5  
GCCTTTTTCGCAACGGGTTTGCCGCCCAAACCCCGGTGTCGTGAAAACTACCCCTAGCNC
HKR182036 ARi55B12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR182579 ARi56H11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR183273 ARi58D01 pGCAP10 NM_001402.5  
GCTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR183328 ARi58F08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR183683 ARi59D11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGANNACAGGTGTCGTGAANCTACCCCTAAAGCCA
HKR183772 ARi59H04 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR184149 ARi60G05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR184931 ARi62F11 pGCAP10 NM_001402.5  
GCTTTTTCTCATCGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR185251 ARi63C03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR186059 ARi65C11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR186458 ARi66C10 pGCAP10 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR187225 ARi68B01 pGCAP10 NM_001402.5  
TGGTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR187250 ARi68C02 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR187253 ARi68C05 pGCAP10 NM_001402.5  
TGCTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR188009 ARi70A09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR188012 ARi70A12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR203333 ARiS008F13 pGCAP10 NM_001402.5  
CTTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR203425 ARiS008J09 pGCAP10 NM_001402.5  
CGGCCGGCCGATGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACT
HKR203500 ARiS008M12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACNNNNTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR205227 ARiS013B03 pGCAP10 NM_001402.5  
GcTTTTTTTCgCAACggGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR205447 ARiS013K07 pGCAP10 NM_001402.5  
GCTTTTTCNCAACNNNNTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR205576 ARiS013P16 pGCAP10 NM_001402.5  
GCTTTTTNNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR208002 ARiS020A02 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR208003 ARiS020A03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR208053 ARiS020C05 pGCAP10 NM_001402.5  
TTGGCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCC
HKR208083 ARiS020D11 pGCAP10 NM_001402.5  
GcTTttTCgCAacgggtTTGCCNGCGCGCTCNGGNNNCANCGNGAACTNCCNNNNNTGCC
HKR208102 ARiS020E06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR208199 ARiS020I07 pGCAP10 NM_001402.5  
GCTTTTTCNCATCNGGTTTGCCGCCAGAACACAGGTGTCNTGAAAACTACCCCTAAANGC
HKR208256 ARiS020K16 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR208301 ARiS020M13 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR209262 ARiS023C14 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR209369 ARiS023H01 pGCAP10 NM_001402.5  
TGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR209381 ARiS023H13 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR209509 ARiS023M21 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR209518 ARiS023N06 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR209560 ARiS023O24 pGCAP10 NM_001402.5  
GCTTTTTCNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR218070 ARiS045C22 pGCAP10 NM_001402.5  
GCTTTTTCGCANCGGGTTNGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR218378 ARiS045P18 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR219712 ARiS049E16 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR219808 ARiS049I16 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR219872 ARiS049L08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR219876 ARiS049L12 pGCAP10 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR219900 ARiS049M12 pGCAP10 NM_001402.5  
GctttttCgcAaCNCNCTNNNNNNCCNTTNCTTTNGNGNNNNNNNNCCNNNCCCNGGAGG
HKR219968 ARiS049P08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR222161 ARiS055G17 pGCAP10 NM_001402.5  
CTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR222202 ARiS055I10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR222247 ARiS055K07 pGCAP10 NM_001402.5  
GCTTTTTTCNCNNCNGGTTTGCCGCCNNAACACAGGTGTCGTGAAAACTACCCCTAAAAN
HKR234105 ARiS085E09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR234192 ARiS085H24 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR234260 ARiS085K20 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR234349 ARiS085O13 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR234821 ARiS087A21 pGCAP10 NM_001402.5  
GCtttttCgCaaCGGGNTNNGCCGCCANNNCACAGGNGTCGTGAAAACTACCCCTAAAAG
HKR235052 ARiS087K12 pGCAP10 NM_001402.5  
gcTTTTTcgCAACGGGTTTGCCNCCAAAACANNNGTGTCGNGAAAACTACCCC
HKR235086 ARiS087L22 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR235112 ARiS087M24 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR235204 ARiS088A04 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR235246 ARiS088B22 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR235252 ARiS088C04 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR235316 ARiS088E20 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR235395 ARiS088I03 pGCAP10 NM_001402.5  
GCTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR235517 ARiS088N05 pGCAP10 NM_001402.5  
GCTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR235520 ARiS088N08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR238490 ARiS096D18 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR238553 ARiS096G09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR238575 ARiS096H07 pGCAP10 NM_001402.5  
GCTTTTTCCCAACGNTTTTGCCNCCNGAACACANGTGTNNTGAAAACTACCCCTAANNNC
HKR238601 ARiS096I09 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR238730 ARiS096N18 pGCAP10 NM_001402.5  
GCTTTTTCNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR243970 ARiS109P10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR247309 ARiS118E13 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR247466 ARiS118L02 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR247483 ARiS118L19 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR247519 ARiS118N07 pGCAP10 NM_001402.5  
GCTTTTTNNNANCNNNTTTGCCNCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR249172 ARiS122P12 pGCAP10 NM_001402.5  
TGGCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCT
HKR260070 ARiS150C22 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR260349 ARiS150O13 pGCAP10 NM_001402.5  
GCTTTTTNNNNACNGNTTTGCCNCCNNAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR264405 ARiS161A05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR264669 ARiS161L05 pGCAP10 NM_001402.5  
GCTTTTTTCNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR276412 ARiS191A12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR276614 ARiS191I22 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR276657 ARiS191K17 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR277701 ARiS194E05 pGCAP10 NM_001402.5  
GCTTTTTTTTTCNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR277871 ARiS194L07 pGCAP10 NM_001402.5  
TTTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR277922 ARiS194N10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR279306 ARiS198E10 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR279344 ARiS198F24 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR320931 RBb02F11 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR320954 RBb02G10 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACACGCTTTCGATGAAAACTACCCCTAAAA
HKR321273 RBb03D01 pKA1U5 NM_001402.5  
ATTGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR321652 RBb04C04 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGCTGTCGTGAAAACTACCCCTAAAAG
HKR322107 RBb05E11 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR324002 RBb10A02 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR325205 RBb13A05 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR325723 RBb14F03 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR326108 RBb15E12 pKA1U5 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTTCGTGAAAACTACCCCTAAAAG
HKR329611 RBb24A11 pGCAP1 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR331346 RBb28G02 pGCAP1 NM_001402.5  
CTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGCTCGTTGAAAACTACCCCTA
HKR331775 RBb29H07 pGCAP1 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR334073 RBb35D01 pGCAP1 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR334427 RBb36B03 pGCAP1 NM_001402.5  
CTTTTTTCGCAACGGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR337651 RBb44C03 pGCAP1 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR340835 RBb52B11 pGCAP1 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR346031 RBb65B07 pGCAP1 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR346459 RBb66C11 pGCAP1 NM_001402.5  
TGGAGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR348547 RBb71G03 pGCAP1 NM_001402.5  
GCTCCACCCTCCACCCTCCACCCCTCCACCCCTCCACCCTCCACCCTCATCCCTTTCTTC
HKR360429 RBd01B05 pGCAP10 NM_001402.5  
HKR362805 RBd07A05 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR364049 RBd10C01 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR364925 RBd12F05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR365235 RBd13B11 pGCAP10 NM_001402.5  
GCTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR365633 RBd14B09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR366401 RBd16A01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR366548 RBd16G04 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR368831 RBd22B07 pGCAP10 NM_001402.5  
TTGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR370178 RBd25H10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR370930 RBd27F10 pGCAP10 NM_001402.5  
GTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR370947 RBd27G03 pGCAP10 NM_001402.5  
GCTTTTTTTCCTTTTTGTTGCCGCCCCAGGTGGTTGCTCGTGAAAACTACCCCTAAAAGC
HKR370950 RBd27G06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR371704 RBd29E08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR372074 RBd30D02 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR372973 RBd32H05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR373606 RBd34A06 pGCAP10 NM_001402.5  
GCTTTTTTTTTTTCCCAACGGGTTTGCCCCCCGAACACCGGGGTCGTGAAAACTACCCCT
HKR374127 RBd35F07 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR374407 RBd36A07 pGCAP10 NM_001402.5  
CCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR374430 RBd36B06 pGCAP10 NM_001402.5  
TGCTTTTTCCCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR375229 RBd38B05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR376855 RBd42C07 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR377780 RBd44H12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR378028 RBd45B04 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR378804 RBd47A04 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR378858 RBd47C10 pGCAP10 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR378977 RBd47H09 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR379327 RBd48F07 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR379329 RBd48F09 pGCAP10 NM_001402.5  
TGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR379369 RBd48H01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR380450 RBd51C02 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR381329 RBd53F09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR382049 RBd55C01 pGCAP10 NM_001402.5  
TAAGCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR382532 RBd56F12 pGCAP10 NM_001402.5  
GTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCNNCNTGAACGTTCTTTT
HKR383231 RBd58B07 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGNNANNTACCCCTAAAAGC
HKR383251 RBd58C03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR384006 RBd60A06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR384027 RBd60B03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR384125 RBd60F05 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR384449 RBd61C01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR384973 RBd62H05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR384978 RBd62H10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR386827 RBd67B03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR387306 RBd68E10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR387324 RBd68F04 pGCAP10 NM_001402.5  
TGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR388874 RBd72D02 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR389684 RBd74D12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR389731 RBd74F11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR391249 RBd78C01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR391730 RBd79F10 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR392451 RBd81C03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR394169 RBd85H01 pGCAP10 NM_001402.5  
GTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR394429 RBd86B05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR394435 RBd86B11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR394578 RBd86H10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR395353 RBd88G09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR395608 RBd89A08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR396401 RBd91A01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR396406 RBd91A06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR397201 RBd93A01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR397610 RBd94A10 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR398083 RBd95D11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR398105 RBd95E09 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR398556 RBd96G12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR402801 RBdS007A01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR402976 RBdS007H08 pGCAP10 NM_001402.5  
GTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGCC
HKR402992 RBdS007H24 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR403015 RBdS007I23 pGCAP10 NM_001402.5  
TGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR403055 RBdS007K15 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR403124 RBdS007N12 pGCAP10 NM_001402.5  
AAGCTTTTTCCCAACGGGTTTGCCGCCANAACACNGGTGTCGTGAAAACTACCCCTAAAA
HKR405201 RBdS013A01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR405501 RBdS013M13 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGNTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR405604 RBdS014A04 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR405684 RBdS014D12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR405883 RBdS014L19 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR405899 RBdS014M11 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR406131 RBdS015F11 pGCAP10 NM_001402.5  
GCTTTCNNNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR406193 RBdS015I01 pGCAP10 NM_001402.5  
GCTCTCCGCCAGACCGCCGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTATCA
HKR406194 RBdS015I02 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR406360 RBdS015O24 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR406365 RBdS015P05 pGCAP10 NM_001402.5  
CGTGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR408875 RBdS022D03 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR409104 RBdS022M16 pGCAP10 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR416019 RBdS040A19 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR416044 RBdS040B20 pGCAP10 NM_001402.5  
GNTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR420408 RBdS051A08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR420606 RBdS051I14 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR420723 RBdS051N11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR428113 RBdS070E17 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR428123 RBdS070F03 pGCAP10 NM_001402.5  
GCTTTTTCNCANCGGGTTTGCCNCCAGAACACAGGTGTCGTGAAAACTNCCCCTANNNNC
HKR428138 RBdS070F18 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR428208 RBdS070I16 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR430034 RBdS075B10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGG
HKR430079 RBdS075D07 pGCAP10 NM_001402.5  
GCTTTTTCNCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR430131 RBdS075F11 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR430237 RBdS075J21 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR432416 RBdS081A16 pGCAP10 NM_001402.5  
GCTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR432417 RBdS081A17 pGCAP10 NM_001402.5  
GGGGCGCCTTGTCNCACGCANCTCCAGGCGGGGCAGCCCCGGTAGCTGAGGGACGCAGCT
HKR432656 RBdS081K16 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR432666 RBdS081L02 pGCAP10 NM_001402.5  
TGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR432718 RBdS081N06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR433373 RBdS083H05 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR433405 RBdS083I13 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR433418 RBdS083J02 pGCAP10 NM_001402.5  
TTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR441610 RBdS104A10 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR442025 RBdS105B01 pGCAP10 NM_001402.5  
TGGCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAA
HKR442325 RBdS105N13 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR444021 RBdS110A21 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR452920 RBdS132E24 pGCAP10 NM_001402.5  
GCTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAG
HKR452936 RBdS132F16 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR453089 RBdS132M01 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR453157 RBdS132O21 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR461885 RBdS154L21 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR461890 RBdS154M02 pGCAP10 NM_001402.5  
GCTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR461948 RBdS154O12 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR462476 RBdS156D04 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR470938 RBdS177F18 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR471026 RBdS177J10 pGCAP10 NM_001402.5  
GCTTTTTTTTTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTA
HKR471046 RBdS177K06 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR471088 RBdS177L24 pGCAP10 NM_001402.5  
CTTTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAA
HKR474817 RBdS187A17 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR475038 RBdS187J22 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC
HKR475089 RBdS187M01 pGCAP10 NM_001402.5  
GCTTTTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAA
HKR475168 RBdS187P08 pGCAP10 NM_001402.5  
GCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTGTCGTGAAAACTACCCCTAAAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl