Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177D22

Clone ID RBdS177D22
HP ID HP09259
Gene ID 56905
Gene Symbol C15orf39
Protein Name chromosome 15 open reading frame 39
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015492.4
Length of RefSeq (bp) 4443
Chromosome 15q24.2
Reference DDBJ accession
UniGene Hs.17936
5'-terminal sequence GAGANGGCGCCCAGCGGCGGCGCGAACGGCAGCTAGGAGGGTTGCTCCGGGCTTGGTGCT
2011.08.28