Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C15orf39

Gene ID (NCBI) 56905
Gene Symbol C15orf39
Protein Name chromosome 15 open reading frame 39
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005313 IRAK013E17 pCMV-SPORT6 BC011379 NM_015492
HGY082015 IRAL005A15 pOTB7 BC000540 NM_015492 Partial/var
HGY084616 IRAL011I24 pOTB7 BC006207 NM_015492 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE092003 M01C030A03 pDONR221 MGC04-E02 BC011379 ENST00000360639
HGE092051 M01C030C03 pDONR221 MGC04-E02 BC011379 ENST00000360639
HGE092099 M01C030E03 pDONR221 MGC04-E02 BC011379 ENST00000360639
HGE092147 M01C030G03 pDONR221 MGC04-E02 BC011379 ENST00000360639
HGE092195 M01C030I03 pDONR221 MGC04-E02 BC011379 ENST00000360639
HGE092243 M01C030K03 pDONR221 MGC04-E02 BC011379 ENST00000360639
HGE092291 M01C030M03 pDONR221 MGC04-E02 BC011379 ENST00000360639
HGE092339 M01C030O03 pDONR221 MGC04-E02 BC011379 ENST00000360639

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR470894 RBdS177D22 pGCAP10 NM_015492.4
GAGANGGCGCCCAGCGGCGGCGCGAACGGCAGCTAGGAGGGTTGCTCCGGGCTTGGTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl