Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156C18

Clone ID RBdS156C18
HP ID HP03131
Gene ID 5985
Gene Symbol RFC5
Protein Name replication factor C (activator 1) 5, 36.5kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_007370.4
Length of RefSeq (bp) 2121
Chromosome 12q24.23
Reference DDBJ accession
UniGene Hs.506989
5'-terminal sequence GGTCAGGTCGCGGCTGGTCACTGTGCAGGCGCTTGGGTGACGCGACGATCTCAGCGGATC
2011.08.28