Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154G03

Clone ID RBdS154G03
HP ID HP00369
Gene ID 1340
Gene Symbol COX6B1
Protein Name cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001863.3
Length of RefSeq (bp) 578
Chromosome 19q13.1
Reference DDBJ accession
UniGene Hs.431668
5'-terminal sequence GTTTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTCAGC
2011.08.28