Prev. |  KEGG KO K02267 > 

RIKEN DNA Bank Human Resource - COX6B1

Gene ID NCBI Gene 1340 |  KEGG hsa:1340
Gene Symbol COX6B1
Protein Name cytochrome c oxidase subunit 6B1
Synonyms COX6B|COXG|COXVIb1
Ortholog resources KEGG ortholog (KEGG orthology K02267) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082266 IRAL005L02 pOTB7 BC002478 NM_001863 Full
HGY082279 IRAL005L15 pOTB7 BC001015 NM_001863

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043204 ARe08A04 pKA1U5 NM_001863.3  
GCCTGTCCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGG
HKR060407 ARe51A07 pKA1U5 NM_001863.3  
GCCTGTCCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGG
HKR171774 ARi29H06 pGCAP10 NM_001863.3  
GTTCCTGTCCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGG
HKR218251 ARiS045K11 pGCAP10 NM_001863.3  
GGTGGTGTCTTTGCTNNNGGTCACNTTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGA
HKR334035 RBb35B11 pGCAP1 NM_001863.3  
GCCTGTCCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTTGAATCCGGG
HKR340178 RBb50H10 pGCAP1 NM_001863.3  
GCCTGTCCGACTGNTGGTGTCTTTGCTGAGGGTCACATTGANCTGCAGGNTTGAATCCGG
HKR344860 RBb62C12 pGCAP1 NM_001863.3  
HKR346924 RBb67F04 pGCAP1 NM_001863.3  
GGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTCAG
HKR383273 RBd58D01 pGCAP10 NM_001863.3  
GAGTCCCCACCTCTCTCAGCTTCCGGCTGGTAGTAGTTCCGCTTCCTGTCCGACTGTGGT
HKR384522 RBd61F02 pGCAP10 NM_001863.3  
GGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTCAGCACCAT
HKR399328 RBd98F08 pGCAP10 NM_001863.3  
GACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTCAGCACCATGGCGGAAGAC
HKR461747 RBdS154G03 pGCAP10 NM_001863.3  
GTTTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTCAGC
HKR475107 RBdS187M19 pGCAP10 NM_001863.3  
GCCTGTCCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl