Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132N06

Clone ID RBdS132N06
HP ID HP03938
Gene ID 1486
Gene Symbol CTBS
Protein Name chitobiase, di-N-acetyl-
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004388.2
Length of RefSeq (bp) 3152
Chromosome 1p22
Reference DDBJ accession
UniGene Hs.513557
5'-terminal sequence GGCTATGTCCCGGCCGCAGCTTCGACGCTGGCTTCTCGTCTCTAGCCCGCCGAGCGGCGT
2011.08.28