Prev. |  KEGG KO K12310 > 

RIKEN DNA Bank Human Resource - CTBS

Gene ID NCBI Gene 1486 |  KEGG hsa:1486
Gene Symbol CTBS
Protein Name chitobiase
Synonyms CTB
Ortholog resources KEGG ortholog (KEGG orthology K12310) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX054155 IRAK135G11 pCMV-SPORT6 BC065191 NM_004388 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR010401 ARa26A01 pKA1U5 NM_004388.2  
GGCTGCTATGTCCCGGCCGCAGCTTCGACGCTGGCGCCTCGATCTCTAGCCCGCCGAGCG
HKR398150 RBd95G06 pGCAP10 NM_004388.2  
GGCTGGCTTCTCGTCTCTAGCCCGCCGAGCGGCGTCCCGGGTCTAGCGCTGCTGGCGCTG
HKR453118 RBdS132N06 pGCAP10 NM_004388.2  
GGCTATGTCCCGGCCGCAGCTTCGACGCTGGCTTCTCGTCTCTAGCCCGCCGAGCGGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl