Prev. |  KEGG KO K12310 > 

RIKEN DNA Bank Human Resource - CTBS

Gene ID NCBI Gene 1486 |  KEGG hsa:1486
Gene Symbol CTBS
Protein Name chitobiase
Synonyms CTB
Ortholog resource in our bank

  CTBS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX054155 IRAK135G11 pCMV-SPORT6 BC065191 NM_004388 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR010401 ARa26A01 pKA1U5 NM_004388.2  
GGCTGCTATGTCCCGGCCGCAGCTTCGACGCTGGCGCCTCGATCTCTAGCCCGCCGAGCG
HKR398150 RBd95G06 pGCAP10 NM_004388.2  
GGCTGGCTTCTCGTCTCTAGCCCGCCGAGCGGCGTCCCGGGTCTAGCGCTGCTGGCGCTG
HKR453118 RBdS132N06 pGCAP10 NM_004388.2  
GGCTATGTCCCGGCCGCAGCTTCGACGCTGGCTTCTCGTCTCTAGCCCGCCGAGCGGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl