Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132F10

Clone ID RBdS132F10
HP ID HP03278
Gene ID 25912
Gene Symbol C1orf43
Protein Name chromosome 1 open reading frame 43
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015449.2
Length of RefSeq (bp) 1807
Chromosome 1q21.2
Reference DDBJ accession
UniGene Hs.287471
5'-terminal sequence GAGGCCGGGTCTGGCTTGGTCTTCCCCCGTAAGGAAATGGCCGGGGAGCTCCAGGGGACC
2011.08.28