Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C1orf43

Gene ID (NCBI) 25912
Gene Symbol C1orf43
Protein Name chromosome 1 open reading frame 43
Synonyms NICE-3|NS5ATP4|S863-3
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001509 IRAK003M21 pCMV-SPORT6 BC000152 NM_015449 Full/var
HGY080879 IRAL002D07 pOTB7 BC006514 NM_015449 Full
HGY081797 IRAL004I05 pOTB7 BC001377 NM_015449 Full
HGY083566 IRAL008P06 pOTB7 BC014391 NM_015449 Full
HGY089238 IRAL023B14 pOTB7 BC008306 NM_138740 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082122 ARf05F02 pKA1U5 NM_015449.2  
GCTCCTGCCTGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCTTCCCCCGTAAGGAA
HKR185299 ARi63E03 pGCAP10 NM_015449.2  
TGCTCCACTTAAACCAGATGTGTTGCAGCTTTCCTGACATGCAAGGATCTACTTTAATTC
HKR222274 ARiS055L10 pGCAP10 NM_015449.2  
TGGGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCTTCCCCCGTAAGGAAATGGCCG
HKR243609 ARiS109A09 pGCAP10 NM_015449.2  
GCCTGCCTGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCTTCCCCCGTAAGGAAAT
HKR371681 RBd29D09 pGCAP10 NM_015449.2  
GCTCCTTTCCCAGCTCTCCTGCCTGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCT
HKR338947 RBb47G03 pGCAP1 NM_015449.2  
GTCCCAGCTCTCCTGCCTGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCTTCCCCC
HKR383752 RBd59G08 pGCAP10 NM_015449.2  
GCTCCTGCCTGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCTTCCCCCGTAAGGAA
HKR387776 RBd69H08 pGCAP10 NM_015449.2  
GCTCCTTTCCCAGCTCTCCTGCCTGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCT
HKR394923 RBd87F03 pGCAP10 NM_015449.2  
GTCTCCTGCCTGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCTTCCCCCGTAAGGA
HKR405659 RBdS014C11 pGCAP10 NM_015449.2  
GCCTGCCTGTCCGCCATGTTTTCAGGCCGGGTCTGGCTTGGTCTTCCCCCGTAAGGAAAT
HKR452930 RBdS132F10 pGCAP10 NM_015449.2  
GAGGCCGGGTCTGGCTTGGTCTTCCCCCGTAAGGAAATGGCCGGGGAGCTCCAGGGGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl