Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110H12

Clone ID RBdS110H12
HP ID HP10702
Gene ID 84798
Gene Symbol C19orf48
Protein Name chromosome 19 open reading frame 48
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_199249.1
Length of RefSeq (bp) 1692
Chromosome 19q13.33
Reference DDBJ accession
UniGene Hs.256301
5'-terminal sequence GGCTTCGGAGAGAGAAATGCTGGGGTGCAGCTTCAAGCTTAGGACCACCCACCATGCCTA
2011.08.28