Prev. | 

RIKEN DNA Bank Human Resource - C19orf48

Gene ID NCBI Gene 84798 |  KEGG hsa:84798
Gene Symbol C19orf48
Protein Name chromosome 19 open reading frame 48
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001546 IRAK003O10 pCMV-SPORT6 BC037227 NM_199250 Full
HGY087295 IRAL018D23 pOTB7 BC006151 NM_199250 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098835 M01C047B11 pDONR221 MGC13-C06 BC006151 NM_199250  
HGE098883 M01C047D11 pDONR221 MGC13-C06 BC006151 NM_199250  
HGE098931 M01C047F11 pDONR221 MGC13-C06 BC006151 NM_199250  
HGE098979 M01C047H11 pDONR221 MGC13-C06 BC006151 NM_199250  
HGE099027 M01C047J11 pDONR221 MGC13-C06 BC006151 NM_199250  
HGE099075 M01C047L11 pDONR221 MGC13-C06 BC006151 NM_199250  
HGE099123 M01C047N11 pDONR221 MGC13-C06 BC006151 NM_199250  
HGE099171 M01C047P11 pDONR221 MGC13-C06 BC006151 NM_199250  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062849 ARe57C01 pKA1U5 NM_199249.1  
TGGCTTCGGAGAGAGAAATGCTGGGGTGCAGCTTCAAGCTTAGGACCACCCACCATGCCT
HKR169258 ARi23C10 pGCAP10 NM_199249.1  
GGCTTCGGAGAGAGAAATGCTGGGGTGCAGCTTCAAGCTTAGGACCACCCACCATGCCTA
HKR330950 RBb27G06 pGCAP1 NM_199249.1  
GCCGCTTCGGAGAGAGAAATGCTGGGGTGCAGCTTCAAGCTTAGGACCACCCACCATGCC
HKR444180 RBdS110H12 pGCAP10 NM_199249.1  
GGCTTCGGAGAGAGAAATGCTGGGGTGCAGCTTCAAGCTTAGGACCACCCACCATGCCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl