Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110G01

Clone ID RBdS110G01
HP ID HP10525
Gene ID 552900
Gene Symbol BOLA2
Protein Name bolA homolog 2 (E. coli)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001031827.1
Length of RefSeq (bp) 1030
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.444600
5'-terminal sequence GGTGTCCCTGCTGGGCTGCCGTTCCAGCTGGACTGCCGCCATGGAACTCAGCGCCGAATA
2011.08.28