Prev. | 

RIKEN DNA Bank Human Resource - BOLA2

Gene ID NCBI Gene 552900 |  KEGG hsa:552900
Gene Symbol BOLA2
Protein Name bolA family member 2
Synonyms BOLA2A|BOLA2B|My016
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY100484 IRAL051D12 pDNR-LIB BC062756 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR334436 RBb36B12 pGCAP1 NM_001031827.1  
GAGTTGAGCCGCCGGACAAGGGGAAAAGAGCTCGGGGGGCGGGTTCGGCACCATTCATAT
HKR334801 RBb37A01 pGCAP1 NM_001031827.1  
GGCCGCCGGAACAAGGGGAAAAGAGCTCGGGGGGCGGGTTCGGCACCATTCATATTCTTC
HKR362525 RBd06F05 pGCAP10 NM_001031827.1  
GGTTTTCCAGCGGAAGTGGCTCCTGTAAGGCAGCAAGGTAGCGTGGCCGGCGCCCGAGCT
HKR362531 RBd06F11 pGCAP10 NM_001031827.1  
GGGAAGTGGCTCCTGTAAGGCAGCAAGGTAGCGTGGCCGGCGCCCGAGCTGGGGTTGTGT
HKR365254 RBd13C06 pGCAP10 NM_001031827.1  
GGTTTTCCAGCGGAAGTGGCTCCTGTAAGGCAGCAAGGTAGCGTGGCCGGCGCCCGAGCT
HKR378522 RBd46F02 pGCAP10 NM_001031827.1  
GGGAAGTGGCTCCTGTAAGGCAGCAAGGTAGCGTGGCCGGCGCCCGAGCTGGGGTTGTGT
HKR398156 RBd95G12 pGCAP10 NM_001031827.1  
GGAGTTTTCCAGCGGAAGTGGCTCCTGTAAGGCAGCAAGGTAGCGTGGCCGGCGCCCGAG
HKR430321 RBdS075N09 pGCAP10 NM_001031827.1  
GAGCGTGGCCGGCGCCCGAGCTGGGGTTGTGTCCCTGCTGGGCTGCCGTTCCAGCTGGAC
HKR444145 RBdS110G01 pGCAP10 NM_001031827.1  
GGTGTCCCTGCTGGGCTGCCGTTCCAGCTGGACTGCCGCCATGGAACTCAGCGCCGAATA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl