Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110C11

Clone ID RBdS110C11
HP ID HP09154
Gene ID 140680
Gene Symbol C20orf96
Protein Name chromosome 20 open reading frame 96
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_153269.1
Length of RefSeq (bp) 1555
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.348112
5'-terminal sequence GATTGTCCCCGGTAAACTGCAGTTTCTGGTTCGAGACTCCAATCCTGTTTCGAATTGCTG
2011.08.28