Prev. | 

RIKEN DNA Bank Human Resource - C20orf96

Gene ID NCBI Gene 140680 |  KEGG hsa:140680
Gene Symbol C20orf96
Protein Name chromosome 20 open reading frame 96
Synonyms dJ1103G7.2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039338 IRAK098F18 pCMV-SPORT6 BC051762 NM_153269 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE041038 W01A102J22 pENTR-TOPO flj0040c03 AK097394 NM_153269  
HGE041040 W01A102J24 pENTR-TOPO flj0040c03 AK097394 NM_153269  
HGE041066 W01A102L02 pENTR-TOPO flj0040c03 AK097394 NM_153269  
HGE041068 W01A102L04 pENTR-TOPO flj0040c03 AK097394 NM_153269  
HGE041074 W01A102L10 pENTR-TOPO flj0040c03 AK097394 NM_153269  
HGE041076 W01A102L12 pENTR-TOPO flj0040c03 AK097394 NM_153269  
HGE041080 W01A102L16 pENTR-TOPO flj0040c03 AK097394 NM_153269  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR444059 RBdS110C11 pGCAP10 NM_153269.1  
GATTGTCCCCGGTAAACTGCAGTTTCTGGTTCGAGACTCCAATCCTGTTTCGAATTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl