Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105J18

Clone ID RBdS105J18
HP ID HP07531
Gene ID 123811
Gene Symbol C16orf63
Protein Name chromosome 16 open reading frame 63
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_144600.2
Length of RefSeq (bp) 2250
Chromosome 16p13.11
Reference DDBJ accession
UniGene Hs.514179
5'-terminal sequence GGGTGCGGCCCTGGCGGCCGTTGAAAAATGGCGACTGTGGCAGAGTTGAAGGCTGTTTTA
2011.08.28