Prev. |  KEGG KO K16535 > 

RIKEN DNA Bank Human Resource - FOPNL

Gene ID NCBI Gene 123811 |  KEGG hsa:123811
Gene Symbol FOPNL
Protein Name FGFR1OP N-terminal like
Synonyms C16orf63|FOR20|PHSECRG2
Ortholog resource in our bank

  FOPNL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094848 IRAL037B24 pDNR-LIB BC022321 NM_144600 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177353 ARi43G09 pGCAP10 NM_144600.2  
GGAAAAATGGCGACTGTGGCAGAGTTGAAGGCTGTTTTAAAGGACACCTTGGAAAAAAAG
HKR442234 RBdS105J18 pGCAP10 NM_144600.2  
GGGTGCGGCCCTGGCGGCCGTTGAAAAATGGCGACTGTGGCAGAGTTGAAGGCTGTTTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl