Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104H08

Clone ID RBdS104H08
HP ID HP00044
Gene ID 7812
Gene Symbol CSDE1
Protein Name cold shock domain containing E1, RNA-binding
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_007158.4
Length of RefSeq (bp) 4041
Chromosome 1p22
Reference DDBJ accession
UniGene Hs.69855
5'-terminal sequence GGGGCCGTGCTGCTTATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGGTATGAAGTG
2011.08.28