Prev. | 

RIKEN DNA Bank Human Resource - CSDE1

Gene ID NCBI Gene 7812 |  KEGG hsa:7812
Gene Symbol CSDE1
Protein Name cold shock domain containing E1
Synonyms D1S155E|UNR
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025690 IRAK064D18 pCMV-SPORT6 BC032446 NM_007158 Full
HGY092639 IRAL031J23 pDNR-LIB BC021692 NM_007158 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060436 ARe51B12 pKA1U5 NM_007158.4  
GGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGGTATG
HKR080855 ARf02C07 pKA1U5 NM_007158.4  
GGCGAGAGAAGCGAGATTTATTCCTACGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGA
HKR180579 ARi51H11 pGCAP10 NM_007158.4  
GGCTTATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAACA
HKR181258 ARi53C10 pGCAP10 NM_007158.4  
CCAAAGGAACCGCNACGNACCGGGCCGGGCGGCNNNGGCGGCGCTGGAGAGGGGGCGCTG
HKR243763 ARiS109G19 pGCAP10 NM_007158.4  
GCTACNNACNNGGCCGTGCTGCTTATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGG
HKR264490 ARiS161D18 pGCAP10 NM_007158.4  
GNCCGGGNNTTGCTGCTNANNNCGGCNCTGGAGAGGGGGCGCTGAGCTGTTGGGTATGAA
HKR327299 RBb18E03 pKA1U5 NM_007158.4  
GGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGGTATG
HKR348012 RBb70A12 pGCAP1 NM_007158.4  
HKR367776 RBd19H08 pGCAP10 NM_007158.4  
GGCGAGATTTATTCCTACGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAGAGGGGGCG
HKR388804 RBd72A04 pGCAP10 NM_007158.4  
AAAAGATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAACA
HKR398452 RBd96C04 pGCAP10 NM_007158.4  
GTCCTACGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTG
HKR399722 RBd99F02 pGCAP10 NM_007158.4  
GGGCTTATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAAC
HKR405892 RBdS014M04 pGCAP10 NM_007158.4  
GATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAACAGACT
HKR441776 RBdS104H08 pGCAP10 NM_007158.4  
GGGGCCGTGCTGCTTATGGCGGCGCTGGAGAGGGGGCGCTGAGCTGTTGGGTATGAAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl