Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083N08

Clone ID RBdS083N08
HP ID HP09096
Gene ID 152002
Gene Symbol C3orf21
Protein Name chromosome 3 open reading frame 21
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_152531.4
Length of RefSeq (bp) 2830
Chromosome 3q29
Reference DDBJ accession
UniGene Hs.478741
5'-terminal sequence GGCGNCCCCGCCCCTTTCATGGCCGCCGCCTGGCGCCGGGGCTAAGTGGCCGCCGGCGTC
2011.08.28