Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083I05

Clone ID RBdS083I05
HP ID HP01369
Gene ID 51283
Gene Symbol BFAR
Protein Name bifunctional apoptosis regulator
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016561.1
Length of RefSeq (bp) 2531
Chromosome 16p13.12
Reference DDBJ accession
UniGene Hs.435556
5'-terminal sequence GGTGCTGAGAATAATGGCCCGGTTGGCCCGGGACGAGTGGAATGATTAATGATGTTTTGC
2011.08.28