Prev. |  KEGG KO K15684 > 

RIKEN DNA Bank Human Resource - BFAR

Gene ID NCBI Gene 51283 |  KEGG hsa:51283
Gene Symbol BFAR
Protein Name bifunctional apoptosis regulator
Synonyms BAR|RNF47
Ortholog resource in our bank

  BFAR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083339 IRAL008F19 pOTB7 BC003054 NM_016561 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR338027 RBb45B03 pGCAP1 NM_016561.1  
TGCTCTTCCTCTGCTCCCGCGGGGTCTGTGCTGAGAATAATGGCCCGGTTGGCCCGGGAC
HKR433397 RBdS083I05 pGCAP10 NM_016561.1  
GGTGCTGAGAATAATGGCCCGGTTGGCCCGGGACGAGTGGAATGATTAATGATGTTTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl