Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081O10

Clone ID RBdS081O10
HP ID HP06425
Gene ID 136647
Gene Symbol C7orf11
Protein Name chromosome 7 open reading frame 11
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138701.2
Length of RefSeq (bp) 1126
Chromosome 7p14.1
Reference DDBJ accession
UniGene Hs.654989
5'-terminal sequence GGAGGTTTTCGGCTTTGGCTCCTGATATGCAGCGACAGAATTTTCGGCCCCCAACTCCTC
2011.08.28