Prev. | 

RIKEN DNA Bank Human Resource - MPLKIP

Gene ID NCBI Gene 136647 |  KEGG hsa:136647
Gene Symbol MPLKIP
Protein Name M-phase specific PLK1 interacting protein
Synonyms ABHS|C7orf11|ORF20|TTD4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094771 IRAL036P11 pDNR-LIB BC026265 NM_138701

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018868 W01A047C20 pENTR-TOPO IRAL036P11 BC026265 NM_138701  
HGE018900 W01A047E04 pENTR-TOPO IRAL036P11 BC026265 NM_138701  
HGE018902 W01A047E06 pENTR-TOPO IRAL036P11 BC026265 NM_138701  
HGE035763 W01A089G19 pENTR-TOPO IRAL036P11 BC026265 NM_138701  
HGE035765 W01A089G21 pENTR-TOPO IRAL036P11 BC026265 NM_138701  
HGE035767 W01A089G23 pENTR-TOPO IRAL036P11 BC026265 NM_138701  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161727 ARi04F07 pGCAP10 NM_138701.2  
GACAGTTCCGGTGGGAGAACGCGGCTGCGAGGTTTTCGGCTTTGGCTCCTGATACGCAGC
HKR360980 RBd02H12 pGCAP10 NM_138701.2  
GACAGTTCCGGTGGGAGAACGCGGCTGCGAGGTTTTCGGCTTTGGCTCCTGATATGCAGC
HKR369370 RBd23H02 pGCAP10 NM_138701.2  
GGATACAGTTCCGGTGGGAGAACGCGGCTGCGAGGTTTTCGGCTTTGGCTCCTGATATGC
HKR405366 RBdS013G22 pGCAP10 NM_138701.2  
GTGACAGTTCCGGTGGGAGAACGCGGCTGCGAGGTTTTCGGCTTTGGCTCCTGATATGCA
HKR432746 RBdS081O10 pGCAP10 NM_138701.2  
GGAGGTTTTCGGCTTTGGCTCCTGATATGCAGCGACAGAATTTTCGGCCCCCAACTCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl