Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MPLKIP

Gene ID (NCBI) 136647
Gene Symbol MPLKIP
Protein Name M-phase specific PLK1 interacting protein
Synonyms ABHS|C7orf11|ORF20
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY094771 IRAL036P11 pDNR-LIB BC026265 NM_138701

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE018868 W01A047C20 pENTR-TOPO IRAL036P11 BC026265 NM_138701
HGE018900 W01A047E04 pENTR-TOPO IRAL036P11 BC026265 NM_138701
HGE018902 W01A047E06 pENTR-TOPO IRAL036P11 BC026265 NM_138701
HGE035763 W01A089G19 pENTR-TOPO IRAL036P11 BC026265 NM_138701
HGE035765 W01A089G21 pENTR-TOPO IRAL036P11 BC026265 NM_138701
HGE035767 W01A089G23 pENTR-TOPO IRAL036P11 BC026265 NM_138701

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR161727 ARi04F07 pGCAP10 NM_138701.2
GACAGTTCCGGTGGGAGAACGCGGCTGCGAGGTTTTCGGCTTTGGCTCCTGATACGCAGC
HKR360980 RBd02H12 pGCAP10 NM_138701.2
GACAGTTCCGGTGGGAGAACGCGGCTGCGAGGTTTTCGGCTTTGGCTCCTGATATGCAGC
HKR369370 RBd23H02 pGCAP10 NM_138701.2
GGATACAGTTCCGGTGGGAGAACGCGGCTGCGAGGTTTTCGGCTTTGGCTCCTGATATGC
HKR405366 RBdS013G22 pGCAP10 NM_138701.2
GTGACAGTTCCGGTGGGAGAACGCGGCTGCGAGGTTTTCGGCTTTGGCTCCTGATATGCA
HKR432746 RBdS081O10 pGCAP10 NM_138701.2
GGAGGTTTTCGGCTTTGGCTCCTGATATGCAGCGACAGAATTTTCGGCCCCCAACTCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl