Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081N23

Clone ID RBdS081N23
HP ID HP00844
Gene ID 5965
Gene Symbol RECQL
Protein Name RecQ protein-like (DNA helicase Q1-like)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002907.3
Length of RefSeq (bp) 3795
Chromosome 12p12
Reference DDBJ accession
UniGene Hs.235069
5'-terminal sequence GGAGGCCTGGGTGCTTTAGTGTCGGAGATCCGAGAGTCGGAGATCGGAGAGTCGGACACA
2011.08.28