Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081L20

Clone ID RBdS081L20
HP ID HP09067
Gene ID 65055
Gene Symbol REEP1
Protein Name receptor accessory protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_022912.2
Length of RefSeq (bp) 3868
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.368884
5'-terminal sequence CAGTCTGGCGGCGGCTGCCGTGAGCTGACTGACGTTCCGGGAACGCCGCAGCAGCCCGCG
2011.08.28