Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081H06

Clone ID RBdS081H06
HP ID HP06323
Gene ID 171546
Gene Symbol C14orf147
Protein Name chromosome 14 open reading frame 147
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138288.3
Length of RefSeq (bp) 2538
Chromosome 14q13.1
Reference DDBJ accession
UniGene Hs.269909
5'-terminal sequence GAGACTGACGTGTGAGCTGCATCGCGGGAGGCGCATGGCGGGGATGGCGCTGGCGCGGGC
2011.08.28