Prev. | 

RIKEN DNA Bank Human Resource - SPTSSA

Gene ID NCBI Gene 171546 |  KEGG hsa:171546
Gene Symbol SPTSSA
Protein Name serine palmitoyltransferase small subunit A
Synonyms C14orf147|SSSPTA
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067255 IRAK168C07 pBluescriptR BC068480 NM_138288 Full
HGY093065 IRAL032L01 pDNR-LIB BC016808 NM_138288 Full
HGY093082 IRAL032L18 pDNR-LIB BC016805 NM_138288 Full
HGY093151 IRAL032O15 pDNR-LIB BC021701 NM_138288 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165231 ARi13B07 pGCAP10 NM_138288.3  
GAGACTGACGTGTGAGCTGCATCGCGGGAGGCGCATGGCGGGGATGGCGCTGGCGCGGGC
HKR177284 ARi43D12 pGCAP10 NM_138288.3  
GAGACTGACGTGTGAGCTGCATCGCGGGAGGCGCATGGCGGGGATGGCGCTGGCGCGGGC
HKR177369 ARi43H01 pGCAP10 NM_138288.3  
GAGACTGACTTGTGAGCTGCGTCGCGAGAGGCNCATGGCCGGGACGGCTCTGGCGCGGGC
HKR177370 ARi43H02 pGCAP10 NM_138288.3  
GAGACTGACGTGTGAGCTGCATCGCGGGAGGCGCATGGCGGGGATGGCGCTGGCGCGGGC
HKR377702 RBd44E06 pGCAP10 NM_138288.3  
GAGACTGACGTGTGAGCTGCATCGCGGGAGGCGCATGGCGGGGATGGCGCTGGCGCGGGC
HKR383329 RBd58F09 pGCAP10 NM_138288.3  
GAGACTGACGTGTGAGCTGCATCGCGGGAGGCGCATGGCGGGGATGGCGCTGGCGCGGGC
HKR398003 RBd95A03 pGCAP10 NM_138288.3  
GAGACTGACGTGTGAGCTGCATCGCGGGAGGCGCATGGCGGGGATGGCGCTGGCGCGGGC
HKR428170 RBdS070H02 pGCAP10 NM_138288.3  
GGGGCCTGGCGGCCGGGGGCTTTAGGACGTGAGCGGGCGGCCGGCCGGACAGACTGACGT
HKR432574 RBdS081H06 pGCAP10 NM_138288.3  
GAGACTGACGTGTGAGCTGCATCGCGGGAGGCGCATGGCGGGGATGGCGCTGGCGCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl