Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075A23

Clone ID RBdS075A23
HP ID HP00162
Gene ID 1327
Gene Symbol COX4I1
Protein Name cytochrome c oxidase subunit IV isoform 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001861.2
Length of RefSeq (bp) 802
Chromosome 16q22-qter
Reference DDBJ accession
UniGene Hs.433419
5'-terminal sequence GACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGG
2011.08.28