Prev. |  KEGG KO K02263 > 

RIKEN DNA Bank Human Resource - COX4I1

Gene ID NCBI Gene 1327 |  KEGG hsa:1327
Gene Symbol COX4I1
Protein Name cytochrome c oxidase subunit 4I1
Synonyms COX IV-1|COX4|COX4-1|COXIV|COXIV-1
Ortholog resources KEGG ortholog (KEGG orthology K02263) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088908 IRAL022E12 pOTB7 BC008704 NM_001861 Full
HGY090769 IRAL026P09 pOTB7 BC021236 NM_001861 Full
HGY100691 IRAL051M03 pDNR-LIB BC062437 NM_001861 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041330 ARe03F10 pKA1U5 NM_001861.2  
GGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTAC
HKR042425 ARe06B01 pKA1U5 NM_001861.2  
GCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGA
HKR042576 ARe06H08 pKA1U5 NM_001861.2  
GCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAAT
HKR043374 ARe08H06 pKA1U5 NM_001861.2  
GGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGC
HKR066880 ARe67D08 pKA1U5 NM_001861.2  
GCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAAT
HKR072954 ARe82G10 pKA1U5 NM_001861.2  
GGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGC
HKR072979 ARe82H11 pKA1U5 NM_001861.2  
GGCGGCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCA
HKR162802 ARi07A02 pGCAP10 NM_001861.2  
GGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGG
HKR166810 ARi17A10 pGCAP10 NM_001861.2  
GGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGG
HKR171370 ARi28H02 pGCAP10 NM_001861.2  
GCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAAT
HKR203323 ARiS008F03 pGCAP10 NM_001861.2  
GCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGG
HKR235156 ARiS087O20 pGCAP10 NM_001861.2  
GCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGA
HKR243981 ARiS109P21 pGCAP10 NM_001861.2  
TGCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAG
HKR249099 ARiS122M11 pGCAP10 NM_001861.2  
GGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCC
HKR325700 RBb14E04 pKA1U5 NM_001861.2  
GTCCGGTCGCGGGTACACCGGGNTGTAGAGGGCGCCCTNGGCGGGCAGTGGCGGCAGAAT
HKR329349 RBb23G05 pGCAP1 NM_001861.2  
GGTGGTGCTCCGCGGCGCGGCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGG
HKR330012 RBb25A12 pGCAP1 NM_001861.2  
GGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCC
HKR332123 RBb30F03 pGCAP1 NM_001861.2  
GGCGGCGCGGCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGC
HKR338449 RBb46C01 pGCAP1 NM_001861.2  
GGCTCCGCGGCGCGGCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTC
HKR366005 RBd15A05 pGCAP10 NM_001861.2  
GCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGA
HKR376812 RBd42A12 pGCAP10 NM_001861.2  
GCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGA
HKR378801 RBd47A01 pGCAP10 NM_001861.2  
GCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAAT
HKR381604 RBd54A04 pGCAP10 NM_001861.2  
GAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCNNNNNNGGTATTTAGCCTA
HKR381628 RBd54B04 pGCAP10 NM_001861.2  
GAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACNNNGGTATTTAGCCTA
HKR382525 RBd56F05 pGCAP10 NM_001861.2  
GGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGNCNNNNNNNGCAGTGGCGGC
HKR385283 RBd63D11 pGCAP10 NM_001861.2  
GGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCC
HKR399731 RBd99F11 pGCAP10 NM_001861.2  
GGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGG
HKR408861 RBdS022C13 pGCAP10 NM_001861.2  
TGGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCCTAGTTGGC
HKR428066 RBdS070C18 pGCAP10 NM_001861.2  
GGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCC
HKR430023 RBdS075A23 pGCAP10 NM_001861.2  
GACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGG
HKR430063 RBdS075C15 pGCAP10 NM_001861.2  
GACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGG
HKR474977 RBdS187H09 pGCAP10 NM_001861.2  
GGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAG
HKR475071 RBdS187L07 pGCAP10 NM_001861.2  
GCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl