Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040H08

Clone ID RBdS040H08
HP ID HP03238
Gene ID 55973
Gene Symbol BCAP29
Protein Name B-cell receptor-associated protein 29
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001008405.1
Length of RefSeq (bp) 2971
Chromosome 7q22-q31
Reference DDBJ accession
UniGene Hs.303787
5'-terminal sequence GGTCCCGCGCGTCGGCGGCCGCGGAGCAGCGCAGGGAGCCAGGCGGGCTGCCGGCGGGTG
2011.08.28