Prev. | 

RIKEN DNA Bank Human Resource - BCAP29

Gene ID NCBI Gene 55973 |  KEGG hsa:55973
Gene Symbol BCAP29
Protein Name B cell receptor associated protein 29
Synonyms BAP29
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088536 IRAL021F16 pDNR-LIB BC008478 NM_018844 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR367774 RBd19H06 pGCAP10 NM_001008405.1  
TACTCATTTTAATCTTCTGCCTACCTTTTATTCCTCCTCAGAGATGGCAGAAGATTTTTT
HKR416176 RBdS040H08 pGCAP10 NM_001008405.1  
GGTCCCGCGCGTCGGCGGCCGCGGAGCAGCGCAGGGAGCCAGGCGGGCTGCCGGCGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl