Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022K10

Clone ID RBdS022K10
HP ID HP04444
Gene ID 27101
Gene Symbol CACYBP
Protein Name calcyclin binding protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014412.2
Length of RefSeq (bp) 3060
Chromosome 1q24-q25
Reference DDBJ accession
UniGene Hs.508524
5'-terminal sequence GGGTGTGGGCGCAGGCTGCAGCGCCGCGACTCGTGCGGGTAGGCGTCTGCGCTCGGTTTG
2011.08.28