Prev. |  KEGG KO K04507 > 

RIKEN DNA Bank Human Resource - CACYBP

Gene ID NCBI Gene 27101 |  KEGG hsa:27101
Gene Symbol CACYBP
Protein Name calcyclin binding protein
Synonyms GIG5|PNAS-107|S100A6BP|SIP
Ortholog resources KEGG ortholog (KEGG orthology K04507) in the DNA Bank
Featured content Wnt signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067038 IRAK167J22 pBluescriptR BC067823 NM_014412 Full/var
HGX069777 IRAK174H09 pCMV-SPORT6 BC078151 NM_001007214 Full
HGY088577 IRAL021H09 pDNR-LIB BC005975 NM_001007214 Full
HGY094276 IRAL035L12 pDNR-LIB BC022352 NM_001007214 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040646 W01A101K06 pENTR-TOPO IRAL021H09 BC005975 NM_001007214  
HGE040650 W01A101K10 pENTR-TOPO IRAL021H09 BC005975 NM_001007214  
HGE040654 W01A101K14 pENTR-TOPO IRAL021H09 BC005975 NM_001007214  
HGE040656 W01A101K16 pENTR-TOPO IRAL021H09 BC005975 NM_001007214  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057205 ARe43A05 pKA1U5 NM_014412.2  
GAGGCGTCTGCGCTCGGTTTGAGGGCTCGGCGCGGGGTTTCCTGTTCCTCCTTCTGCGCG
HKR062523 ARe56F03 pKA1U5 NM_014412.2  
GGGCGGGCTGTGCGTGCTCGCGGTGGGCGGTGCCGTCNGCTGCCTCGCGAAGGTTCGAGA
HKR063651 ARe59C03 pKA1U5 NM_014412.2  
GGTGCGTGCTCGCGGTGGGCGGTGGCGGCGGCTGCCTCGCGAAGGTTCGAGATCCGTCGC
HKR082969 ARf07H01 pKA1U5 NM_014412.2  
ATCCTGGGCGGGCTGTGCGTGCTCGCGGTGGGCGGTGGCGGCGGCTGCCTCGCGAAGGTT
HKR168498 ARi21E02 pGCAP10 NM_014412.2  
GAGGCTGCAGCGCCGCGACTCGTGCGGGTAGGCGTCTGCGCTCGGTTTGAGGGCTCGGCG
HKR170553 ARi26G09 pGCAP10 NM_014412.2  
GGGCGGCGGCTGCCTCGCGAAGGTTCGAGATCCGTCGCGTGCGGGAGGCGGGCCGCGATC
HKR174903 ARi37E07 pGCAP10 NM_014412.2  
GGGTGTGGGCGCAGGCTGCAGCGCCGCGACTCGTGCGGGTAGGCGTCTGCGCTCGGTTTG
HKR175307 ARi38E11 pGCAP10 NM_014412.2  
GGGTGTGGGCGCAGGCTGCAGCGCCGCGACTCGTGCGGGTAGGCGTCTGCGCTCGGTTTG
HKR326034 RBb15B10 pKA1U5 NM_014412.2  
GGGCTGCCTCGCGAAGGTTCGAGATCCGTCGCGTGCGGGAGGCGGGCCGCGATCTTGCGC
HKR332526 RBb31F06 pGCAP1 NM_014412.2  
GAGCGCCGCGACTCGTGCGGGTAGGCGTCTGCGCTCGGTTTGAGGGCTCGGCGCGGGGTT
HKR362433 RBd06B09 pGCAP10 NM_014412.2  
GAGGAAGGGTGGGTGGAGCCAGGCTTGGCGGGCTGTGCGTGCTCGCGGTGGGCGGTGGCG
HKR363725 RBd09F05 pGCAP10 NM_014412.2  
GAGGAAGGGTGGGTGGAGCCAGGCTTGGCGGGCTGTGCGTGCTCGCGGTGGGCGGTGGCG
HKR385727 RBd64F07 pGCAP10 NM_014412.2  
TGAGGCTTGGCGGGCTGTGCGTGCTCGCGGTGGGCGGTGGCGGCGGCTGCCTCGCGAAGG
HKR392923 RBd82F03 pGCAP10 NM_014412.2  
GGGTGTGGGCGCAGGCTGCAGCGCCGCGACTCGTGCGGGTAGGCGTCTGCGCTCGGTTTG
HKR405575 RBdS013P15 pGCAP10 NM_014412.2  
GGCGTGCGGGAGGCGGGCCGCGATCTTGCGCAGGGTCGGTGTGGGCGCAGGCTGCAGCGC
HKR405641 RBdS014B17 pGCAP10 NM_014412.2  
GGGCGAGGCGAGGAAGGGTGGGTGGAGCCAGGCTTGGCGGGCTGTGCGTGCTCGCGGTGG
HKR409050 RBdS022K10 pGCAP10 NM_014412.2  
GGGTGTGGGCGCAGGCTGCAGCGCCGCGACTCGTGCGGGTAGGCGTCTGCGCTCGGTTTG
HKR475081 RBdS187L17 pGCAP10 NM_014412.2  
GGGCGGGCCGCGATCTTGCGCAGGGTCGGTGTGGGCGCAGGCTGCAGCGCCGCGACTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl