Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015M13

Clone ID RBdS015M13
HP ID HP04584
Gene ID 115098
Gene Symbol CCDC124
Protein Name coiled-coil domain containing 124
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138442.2
Length of RefSeq (bp) 1061
Chromosome 19p13.11
Reference DDBJ accession
UniGene Hs.100043
5'-terminal sequence GAGGCGCGACCGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTTCC
2011.08.28