Prev. | 

RIKEN DNA Bank Human Resource - CCDC124

Gene ID NCBI Gene 115098 |  KEGG hsa:115098
Gene Symbol CCDC124
Protein Name coiled-coil domain containing 124
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081057 IRAL002K17 pOTB7 BC013949 NM_138442
HGY083675 IRAL009D03 pOTB7 BC013949 NM_138442

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019064 W01A047K24 pENTR-TOPO IRAL002K17 BC013949 NM_138442  
HGE019090 W01A047M02 pENTR-TOPO IRAL002K17 BC013949 NM_138442  
HGE019092 W01A047M04 pENTR-TOPO IRAL002K17 BC013949 NM_138442  
HGE019094 W01A047M06 pENTR-TOPO IRAL002K17 BC013949 NM_138442  
HGE019096 W01A047M08 pENTR-TOPO IRAL002K17 BC013949 NM_138442  
HGE019102 W01A047M14 pENTR-TOPO IRAL002K17 BC013949 NM_138442  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052411 ARe31A11 pKA1U5 NM_138442.2  
GAGGCGCGACCGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTTCC
HKR181633 ARi54B09 pGCAP10 NM_138442.2  
GGGAGGCGCGACCGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTT
HKR320859 RBb02C11 pKA1U5 NM_138442.2  
GGCGACCGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTTCCAGGG
HKR321307 RBb03E11 pKA1U5 NM_138442.2  
GGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATNCCCAAGAAGTTCCAGGGTGAGAA
HKR364036 RBd10B12 pGCAP10 NM_138442.2  
GAGGCGCGACCGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTTCC
HKR405675 RBdS014D03 pGCAP10 NM_138442.2  
GGCGACCGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTTCCAGGG
HKR406301 RBdS015M13 pGCAP10 NM_138442.2  
GAGGCGCGACCGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTTCC
HKR420533 RBdS051F13 pGCAP10 NM_138442.2  
GGCGCGCGACCGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTTCC
HKR428143 RBdS070F23 pGCAP10 NM_138442.2  
TTGCTCTTGCCAGTCTCTATCTCATCTCCTTGGAACTGTGCATCTTTGCTTATCTCTCTC
HKR462604 RBdS156I12 pGCAP10 NM_138442.2  
GGGGCCGGCGCTGGGGTAAGAAGCCTGCTGAGGGATGCCCAAGAAGTTCCAGGGTGAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl