Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015D04

Clone ID RBdS015D04
HP ID HP00703
Gene ID 1349
Gene Symbol COX7B
Protein Name cytochrome c oxidase subunit VIIb
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001866.2
Length of RefSeq (bp) 456
Chromosome Xq21.1
Reference DDBJ accession
UniGene Hs.522699
5'-terminal sequence TGGCTGAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCAGTTCT
2011.08.28