Prev. |  KEGG KO K02271 > 

RIKEN DNA Bank Human Resource - COX7B

Gene ID NCBI Gene 1349 |  KEGG hsa:1349
Gene Symbol COX7B
Protein Name cytochrome c oxidase subunit 7B
Synonyms APLCC|LSDMCA2
Ortholog resources KEGG ortholog (KEGG orthology K02271) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008522 IRAK021F02 pCMV-SPORT6 BC018386 NM_001866 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064903 ARe62E07 pKA1U5 NM_001866.2  
GGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCAGTTCTAGCTTCACCTTCACG
HKR167655 ARi19C07 pGCAP10 NM_001866.2  
GTTTAAAAAACAGCTCATAATTGATGCCAAATTAAAGCACTGTGTACCCATTAAGATATG
HKR167679 ARi19D07 pGCAP10 NM_001866.2  
TGAGCTCACTTCAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGC
HKR347701 RBb69E05 pGCAP1 NM_001866.2  
GAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCAGTTCTAGCTT
HKR364007 RBd10A07 pGCAP10 NM_001866.2  
GACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCAGTTCTAGCTTCACCTT
HKR368007 RBd20A07 pGCAP10 NM_001866.2  
GGTTTTTCAGCTCACTTCAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTAT
HKR405553 RBdS013O17 pGCAP10 NM_001866.2  
GGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCAGTTCTAGCTTCACC
HKR406076 RBdS015D04 pGCAP10 NM_001866.2  
TGGCTGAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCAGTTCT
HKR461863 RBdS154K23 pGCAP10 NM_001866.2  
GAGCTCACTTCAAGGGTACCTGAAGCGAATTGGCACCAAAGCAGCAGCTGTATTGCCGCA
HKR470912 RBdS177E16 pGCAP10 NM_001866.2  
GAGCAGCTGTATTGCCGCAGTTCTAGCTTCACCTTCACGATGTTTCCCTTGGTCAAAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl