Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014N01

Clone ID RBdS014N01
HP ID HP08086
Gene ID 124583
Gene Symbol CANT1
Protein Name calcium activated nucleotidase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138793.2
Length of RefSeq (bp) 3473
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.8859
5'-terminal sequence GAGTCGGCCACCTTCCTCCGTCCCGGCCGTTAGCCCAGCCAAGCCCAGCCAAGCCCAGCC
2011.08.28