Prev. |  KEGG KO K12304 > 

RIKEN DNA Bank Human Resource - CANT1

Gene ID NCBI Gene 124583 |  KEGG hsa:124583
Gene Symbol CANT1
Protein Name calcium activated nucleotidase 1
Synonyms DBQD|DBQD1|EDM7|SCAN-1|SCAN1|SHAPY
Ortholog resources KEGG ortholog (KEGG orthology K12304) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005864 IRAK014K24 pCMV-SPORT6 BC017655 NM_138793 Full
HGX056218 IRAK140J02 pCMV-SPORT6 BC065038 NM_138793 Full
HGY087407 IRAL018I15 pOTB7 BC005104 NM_138793 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006529 W01A016F09 pENTR-TOPO IRAK014K24 BC017655 NM_138793  
HGE006535 W01A016F15 pENTR-TOPO IRAK014K24 BC017655 NM_138793  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR247433 ARiS118J17 pGCAP10 NM_138793.2  
GCCAGAGGCGGGGCGAGCGCGCGCGGGGCGGAAGTCGGCCACCTTCCTCCGTCCCGGCCG
HKR378874 RBd47D02 pGCAP10 NM_138793.2  
GCACCTTCCTCCGTCCCGGCCGTTAGCCCAGCCAAGCCCAGCCAAGCCCAGCCAAGCCCC
HKR405913 RBdS014N01 pGCAP10 NM_138793.2  
GAGTCGGCCACCTTCCTCCGTCCCGGCCGTTAGCCCAGCCAAGCCCAGCCAAGCCCAGCC
HKR405939 RBdS014O03 pGCAP10 NM_138793.2  
GGTTNGGNTNNCTCCNCCCCCCTCNTNCCNGCCTCCNTCCGACNGGNGCNGANACNCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl