Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014K10

Clone ID RBdS014K10
HP ID HP04902
Gene ID 84058
Gene Symbol WDR54
Protein Name WD repeat domain 54
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032118.2
Length of RefSeq (bp) 1146
Chromosome 2p13.1
Reference DDBJ accession
UniGene Hs.643480
5'-terminal sequence GGCGTACGTGCGTCGTCTCTATGGTGGCGGCGGATTTGGAGGGACCCTACGAACCAGGAG
2011.08.28