Prev. | 

RIKEN DNA Bank Human Resource - WDR54

Gene ID NCBI Gene 84058 |  KEGG hsa:84058
Gene Symbol WDR54
Protein Name WD repeat domain 54
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044261 IRAK110K21 pCMV-SPORT6 BC051848 NM_032118

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047371 ARe18H03 pKA1U5 NM_032118.2  
GGTGCGTACGTGCGTCGTCTCTATGGTGGCGGCNGATTTGGAGGGACCCTACGAACCAGG
HKR243662 ARiS109C14 pGCAP10 NM_032118.2  
GGCCGTGCGTACGTGCGTCGTCTCTATGGTGGCGGCGGATTTGGAGGGACCCTACGAACC
HKR339209 RBb48A09 pGCAP1 NM_032118.2  
GGGATTTGGAGGGACCCCTACGNAACCAGGAGTCAGGCGAGCCGATCTGGGGCTGCAGGA
HKR362008 RBd05A08 pGCAP10 NM_032118.2  
GATGGTGGCGGCGGATTTGGAGGGACCCTACGAACCAGGAGTCAGGCGAGCCGATCTGGG
HKR405850 RBdS014K10 pGCAP10 NM_032118.2  
GGCGTACGTGCGTCGTCTCTATGGTGGCGGCGGATTTGGAGGGACCCTACGAACCAGGAG
HKR433544 RBdS083O08 pGCAP10 NM_032118.2  
GGTGCGTACGTGCGTCGTCTCTATGGTGGCGGCGGATTTGGAGGGACCCTACGAACCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl