Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - RBd52G04

Ordering information ordering information
Catalog Number HKR380948
Clone Name RBd52G04
Vector plasmidClick for information pGCAP10
Description Plasmid clone of human WASL(upstream, opposite) cDNA with SV40 promoter
5'-terminal sequence(1) GGGCCGAGGCGCGGACCGCGCGGAGCTAAGTGGAATCCCGGTTGGCTTGGGGCGCAGGCT
Sequence, submitted(2) Not available.
 
HP ID HP05174  finder other clones in this HP group.
Sequence, refered BC067285.1
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

  DDBJ/EMBL/GenBank

Full length sequence and restriction map are not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_160109.pl